📚 Telomere - Wikipedia

Educational content from Wikipedia - The Free Encyclopedia

A telomere (/ˈtɛləmɪər, ˈtiːlə-/; from Ancient Greek τέλος (télos) 'end' and
μέρος (méros) 'part') is a region of repetitive nucleotide sequences associated
with specialized proteins at the ends of linear chromosomes (see Sequences).
Telomeres are a widespread genetic feature most commonly found in eukaryotes.
In most, if not all species possessing them, they protect the terminal regions
of chromosomal DN A from progressive degradation and ensure the integrity of
linear chromosomes by preventing DN A repair systems from mistaking the very
ends of the DN A strand for a double-strand break.

Discovery edit The existence of a special structure at the ends of chromosomes
was independently proposed in 1938 by Hermann Joseph Muller, studying the fruit
fly Drosophila melanogaster, and in 1939 by Barbara Mc Clintock, working with
maize.
Muller observed that the ends of irradiated fruit fly chromosomes did not
present alterations such as deletions or inversions.
He hypothesized the presence of a protective cap, which he coined "telomeres",
from the Greek telos (end) and meros (part).

In the early 1970s, Soviet theorist Alexey Olovnikov first recognized that
chromosomes could not completely replicate their ends; this is known as the "end
replication problem".
Building on this, and accommodating Leonard Hayflick's idea of limited somatic
cell division, Olovnikov suggested that DN A sequences are lost every time a
cell replicates until the loss reaches a critical level, at which point cell
division ends.
According to his theory of marginotomy, DN A sequences at the ends of telomeres
are represented by tandem repeats, which create a buffer that determines the
number of divisions that a certain cell clone can undergo.

Furthermore, it was predicted that a specialized DN A polymerase (originally
called a tandem-DN A-polymerase) could extend telomeres in immortal tissues such
as germ line, cancer cells and stem cells.
It also followed from this hypothesis that organisms with circular genome, such
as bacteria, do not have the end replication problem and therefore do not age.

Olovnikov suggested that in germline cells, cells of vegetatively propagated
organisms, and immortal cell populations such as most cancer cell lines, an
enzyme might be activated to prevent the shortening of DN A termini with each
cell division.
In 1975-1977, Elizabeth Blackburn, working as a postdoctoral fellow at Yale
University with Joseph G.
Gall, discovered the unusual nature of telomeres, with their simple repeated DN
A sequences composing chromosome ends.

Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in
Physiology or Medicine for the discovery of how chromosomes are protected by
telomeres and the enzyme telomerase.
Structure and function edit End replication problem edit During DN A
replication, DN A polymerase cannot replicate the sequences present at the 3'
ends of the parent strands.
This is a consequence of its unidirectional mode of DN A synthesis: it can only
attach new nucleotides to an existing 3'-end (that is, synthesis progresses
5'-3') and thus it requires a primer to initiate replication.

On the leading strand (oriented 5'-3' within the replication fork), DN
A-polymerase continuously replicates from the point of initiation all the way to
the strand's end with the primer (made of RN A) then being excised and
substituted by DN A.
The lagging strand, however, is oriented 3'-5' with respect to the replication
fork so continuous replication by DN A-polymerase is impossible, which
necessitates discontinuous replication involving the repeated synthesis of
primers further 5' of the site of initiation (see lagging strand replication).

The last primer to be involved in lagging-strand replication sits near the
3'-end of the template (corresponding to the potential 5'-end of the
lagging-strand).
Originally it was believed that the last primer would sit at the very end of the
template, thus, once removed, the DN A-polymerase that substitutes primers with
DN A (DN A-Pol δ in eukaryotes)[note 1] would be unable to synthesize the
"replacement DN A" from the 5'-end of the lagging strand so that the template
nucleotides previously paired to the last primer would not be replicated.

It has since been questioned whether the last lagging strand primer is placed
exactly at the 3'-end of the template and it was demonstrated that it is rather
synthesized at a distance of about 70-100 nucleotides which is consistent with
the finding that DN A in cultured human cell is shortened by 50-100 base pairs
per cell division.
If coding sequences are degraded in this process, potentially vital genetic code
would be lost.
Telomeres are non-coding, repetitive sequences located at the termini of linear
chromosomes to act as buffers for those coding sequences further behind.

They "cap" the end-sequences and are progressively degraded in the process of DN
A replication.
The "end replication problem" is exclusive to linear chromosomes as circular
chromosomes do not have ends lying without reach of DN A-polymerases.
Most prokaryotes, relying on circular chromosomes, accordingly do not possess
telomeres.

A small fraction of bacterial chromosomes (such as those in Streptomyces,
Agrobacterium, and Borrelia), however, are linear and possess telomeres, which
are very different from those of the eukaryotic chromosomes in structure and
function.
The known structures of bacterial telomeres take the form of proteins bound to
the ends of linear chromosomes, or hairpin loops of single-stranded DN A at the
ends of the linear chromosomes.
Telomere ends and shelterin edit At the very 3'-end of the telomere there is a
300 base pair overhang which can invade the double-stranded portion of the
telomere forming a structure known as a T-loop.

This loop is analogous to a knot, which stabilizes the telomere, and prevents
the telomere ends from being recognized as breakpoints by the DN A repair
machinery.
Should non-homologous end joining occur at the telomeric ends, chromosomal
fusion would result.
The T-loop is maintained by several proteins, collectively referred to as the
shelterin complex.

In humans, the shelterin complex consists of six proteins identified as TR F1,
TR F2, TI N2, PO T1, TP P1, and RA P1.
In many species, the sequence repeats are enriched in guanine, e.g.
TTAGG G in vertebrates, which allows the formation of G-quadruplexes, a special
conformation of DN A involving non-Watson-Crick base pairing.

There are different subtypes depending on the involvement of single- or
double-stranded DN A, among other things.
There is evidence for the 3'-overhang in ciliates (that possess telomere repeats
similar to those found in vertebrates) to form such G-quadruplexes that
accommodate it, rather than a T-loop.
G-quadruplexes present an obstacle for enzymes such as DN A-polymerases and are
thus thought to be involved in the regulation of replication and transcription.

Telomerase edit Many organisms have a ribonucleoprotein enzyme called
telomerase, which carries out the task of adding repetitive nucleotide sequences
to the ends of the DN A.
Telomerase "replenishes" the telomere "cap" and requires no AT P.
In most multicellular eukaryotic organisms, telomerase is active only in germ
cells, some types of stem cells such as embryonic stem cells, and certain white
blood cells.

Telomerase can be reactivated and telomeres reset back to an embryonic state by
somatic cell nuclear transfer.
The steady shortening of telomeres with each replication in somatic (body) cells
may have a role in senescence and in the prevention of cancer.
This is because the telomeres act as a sort of time-delay "fuse", eventually
running out after a certain number of cell divisions and resulting in the
eventual loss of vital genetic information from the cell's chromosome with
future divisions.

Length edit Telomere length varies greatly between species, from approximately
300 base pairs in yeast to many kilobases in humans, and usually is composed of
arrays of guanine-rich, six- to eight-base-pair-long repeats.
Eukaryotic telomeres normally terminate with 3′ single-stranded-DN A overhang
ranging from 75 to 300 bases, which is essential for telomere maintenance and
capping.
Multiple proteins binding single- and double-stranded telomere DN A have been
identified.

These function in both telomere maintenance and capping.
Telomeres form large loop structures called telomere loops, or T-loops.
Here, the single-stranded DN A curls around in a long circle, stabilized by
telomere-binding proteins.
At the very end of the T-loop, the single-stranded telomere DN A is held onto a
region of double-stranded DN A by the telomere strand disrupting the
double-helical DN A, and base pairing to one of the two strands.

This triple-stranded structure is called a displacement loop or D-loop.
A recent 2025 study suggest individuals with higher vitamin D intake may
experience a slower rate of cellular aging.
The study found that vitamin D supplements could help reduce this shortening,
potentially by lowering inflammation.

However, scientists caution that vitamin D is not a universal remedy, as it does
not appear to impact all chronic illnesses.
Shortening edit Oxidative damage edit Apart from the end replication problem, in
vitro studies have shown that telomeres accumulate damage due to oxidative
stress and that oxidative stress-mediated DN A damage has a major influence on
telomere shortening in vivo.
There is a multitude of ways in which oxidative stress, mediated by reactive
oxygen species (RO S), can lead to DN A damage; however, it is yet unclear
whether the elevated rate in telomeres is brought about by their inherent
susceptibility or a diminished activity of DN A repair systems in these regions.

Despite widespread agreement of the findings, widespread flaws regarding
measurement and sampling have been pointed out; for example, a suspected species
and tissue dependency of oxidative damage to telomeres is said to be
insufficiently accounted for.
Population-based studies have indicated an interaction between anti-oxidant
intake and telomere length.
In the Long Island Breast Cancer Study Project (LIBCS P), authors found a
moderate increase in breast cancer risk among women with the shortest telomeres
and lower dietary intake of beta carotene, vitamin C or E.

These results suggest that cancer risk due to telomere shortening may interact
with other mechanisms of DN A damage, specifically oxidative stress.
Association with aging edit Although telomeres shorten during the lifetime of an
individual, it is telomere shortening-rate rather than telomere length that is
associated with the human lifespan.
Critically short telomeres trigger a DN A damage response and cellular
senescence.

Mice have much longer telomeres, but a greatly accelerated telomere
shortening-rate and greatly reduced lifespan compared to humans and elephants.
Telomere shortening is associated with aging, mortality, and aging-related
diseases in experimental animals.
Although many factors can affect human lifespan, such as smoking, diet, and
exercise, as persons approach the upper limit of human life expectancy, longer
telomeres may be associated with lifespan.

However, vitamin D3 supplementation has been shown to significantly reduce
telomere shortening over four years compared to a placebo, thus preventing
nearly three years' worth of cellular aging, which may help offset telomere
truncation over time.
Potential effect of psychological stress edit Meta-analyses found that increased
perceived psychological stress was associated with a small decrease in telomere
length--but that these associations attenuate to no significant association when
accounting for publication bias.
The literature concerning telomeres as integrative biomarkers of exposure to
stress and adversity is dominated by cross-sectional and correlational studies,
which makes causal interpretation problematic.

A 2020 review argued that the relationship between psychosocial stress and
telomere length appears strongest for stress experienced in utero or early life.
Lengthening edit The phenomenon of limited cellular division was first observed
by Leonard Hayflick, and is now referred to as the Hayflick limit.
Significant discoveries were subsequently made by a group of scientists
organized at Geron Corporation by Geron's founder Michael D.

West, that tied telomere shortening with the Hayflick limit.
The cloning of the catalytic component of telomerase enabled experiments to test
whether the expression of telomerase at levels sufficient to prevent telomere
shortening was capable of immortalizing human cells.
Telomerase was demonstrated in a 1998 publication in Science to be capable of
extending cell lifespan, and now is well-recognized as capable of immortalizing
human somatic cells.

Two studies on long-lived seabirds demonstrate that the role of telomeres is far
from being understood.
In 2003, scientists observed that the telomeres of Leach's storm-petrel
(Oceanodroma leucorhoa) seem to lengthen with chronological age, the first
observed instance of such behaviour of telomeres.
A study reported that telomere length of different mammalian species correlates
inversely rather than directly with lifespan, and concluded that the
contribution of telomere length to lifespan remains controversial.

There is little evidence that, in humans, telomere length is a significant
biomarker of normal aging with respect to important cognitive and physical
abilities.
Sequences edit Experimentally verified and predicted telomere sequence motifs
from more than 9000 species are collected in research community curated database
Telo Base.
Some of the experimentally verified telomere nucleotide sequences are also
listed in Telomerase Database website (see nucleic acid notation for letter
representations).
| Group | Organism | Telomeric repeat (5' to 3' toward the end) | |---|---|---|
| Vertebrates | Human, mouse, Xenopus | TTAGG G | | Filamentous fungi |
Neurospora crassa | TTAGG G | | Slime moulds | Physarum, Didymium | TTAGG G | |
Dictyostelium | A G(1-8) | | | Kinetoplastid protozoa | Trypanosoma, Crithidia |
TTAGG G | | Ciliate protozoa | Tetrahymena, Glaucoma | TTGGG G | | Paramecium |
TTGG G(T/G) | | | Oxytricha, Stylonychia, Euplotes | TTTTGGG G | | |
Apicomplexan protozoa | Plasmodium | TTAGG G(T/C) | | Higher plants |
Arabidopsis thaliana | TTTAGG G | | Cestrum elegans | TTTTTTAGG G | | | Allium |
CTCGGTTATGG G | | | Green algae Chlamydomonas | TTTTAGG G | | | Insects | Bombyx
mori | TTAG G | | Bombus terrestris | TTAGGTTGGG G | | | Vespula vulgaris |
TTGCGTCTGG G | | | Roundworms | Ascaris lumbricoides | TTAGG C | | Fission
yeasts | Schizosaccharomyces pombe | TTA C(A)(C)G(1-8) | | Budding yeasts |
Saccharomyces cerevisiae | TGTGGGTGTGGT G (from RN A template) or G(2-3)(T
G)(1-6)T (consensus) | | Saccharomyces castellii | TCTGGGT G | | | Candida
glabrata | GGGGTCTGGGTGCT G | | | Candida albicans | GGTGTACGGATGTCTAACTTCT T |
| | Candida tropicalis | GGTGT A[C/A]GGATGTCACGATCAT T | | | Candida maltosa |
GGTGTACGGATGCAGACTCGCT T | | | Candida guillermondii | GGTGTA C | | | Candida
pseudotropicalis | GGTGTACGGATTTGATTAGTTATG T | | | Kluyveromyces lactis |
GGTGTACGGATTTGATTAGGTATG T | Research on disease risk edit This section needs
more reliable medical references for verification or relies too heavily on
primary sources.

(March 2018) | Preliminary research indicates that disease risk in aging may be
associated with telomere shortening, senescent cells, or SAS P
(senescence-associated secretory phenotype).
Measurement edit Several techniques are currently employed to assess average
telomere length in eukaryotic cells.
One method is the Terminal Restriction Fragment (TR F) southern blot.

There is a Web-based Analyser of the Length of Telomeres (WALTE R), software
processing the TR F pictures.
A Real-Time PC R assay for telomere length involves determining the
Telomere-to-Single Copy Gene (T/S) ratio, which is demonstrated to be
proportional to the average telomere length in a cell.
Tools have also been developed to estimate the length of telomere from whole
genome sequencing (WG S) experiments.

Amongst these are Tel Seq, Telomerecat and telomere Hunter.
Length estimation from WG S typically works by differentiating telomere
sequencing reads and then inferring the length of telomere that produced that
number of reads.
These methods have been shown to correlate with preexisting methods of
estimation such as PC R and TR F.

Flow-FIS H is used to quantify the length of telomeres in human white blood
cells.
A semi-automated method for measuring the average length of telomeres with Flow
FIS H was published in Nature Protocols in 2006.
While multiple companies offer telomere length measurement services, the utility
of these measurements for widespread clinical or personal use has been
questioned.

Nobel Prize winner Elizabeth Blackburn, who was co-founder of one company,
promoted the clinical utility of telomere length measures.
In wildlife edit During the last two decades, eco-evolutionary studies have
investigated the relevance of life-history traits and environmental conditions
on telomeres of wildlife.
Most of these studies have been conducted in endotherms, i.e. birds and mammals.

They have provided evidence for the inheritance of telomere length; however,
heritability estimates vary greatly within and among species.
Age and telomere length often negatively correlate in vertebrates, but this
decline is variable among taxa and linked to the method used for estimating
telomere length.
In contrast, the available information shows no sex differences in telomere
length across vertebrates.

Phylogeny and life history traits such as body size or the pace of life can also
affect telomere dynamics.
For example, it has been described across species of birds and mammals.

In 2019, a meta-analysis confirmed that the exposure to stressors (e.g.
pathogen infection, competition, reproductive effort and high activity level)
was associated with shorter telomeres across different animal taxa.
Studies on ectotherms, and other non-mammalian organisms, show that there is no
single universal model of telomere erosion; rather, there is wide variation in
relevant dynamics across Metazoa, and even within smaller taxonomic groups these
patterns appear diverse.
See also edit Notes edit- ^ During replication, multiple DN A-polymerases are
involved.

References edit- ^ Varela, E.; Blasco, M. (March 2010).
"2009 Nobel Prize in Physiology or Medicine: telomeres and telomerase".
29 (11): 1561-1565. doi:10.1038/onc.2010.15. ISS N 1476-5594.

PMI D 20237481. S2CI D 11726588. - ^ Muller, H. The Remaking of Chromosomes.
Woods Hole. pp. 181-198. - ^ Olovnikov, A.

"[Principle of marginotomy in template synthesis of polynucleotides]".
Doklady Akademii Nauk SSS R. 201 (6): 1496-1499. ISS N 0002-3264. PMI D 5158754.

^ Olovnikov, A.

(1973-09-14).
"A theory of marginotomy: The incomplete copying of template margin in enzymic
synthesis of polynucleotides and biological significance of the phenomenon".
Journal of Theoretical Biology. 41 (1): 181-190. Bibcode:1973JTh Bi..41..181 O.
doi:10.1016/0022-5193(73)90198-7.

ISS N 0022-5193. PMI D 4754905. - ^ Olovnikov, A.
"Telomeres, telomerase, and aging: origin of the theory".
Experimental Gerontology. 31 (4): 443-448. doi:10.1016/0531-5565(96)00005-8.

ISS N 0531-5565. PMI D 9415101. S2CI D 26381790. - ^ Olovnikov, I.
"[«He always talked about something else...» Alexey Matveyevich Olovnikov and
his unusual science.]".
Advances in Gerontology = Uspekhi Gerontologii.

36 (2): 162-167. doi:10.34922/A E.2023.36.2.001. ISS N 1561-9125.
PMI D 37356090. - ^ "Library Index". olovnikov.com. Retrieved 2024-10-13.

^ a b Blackburn E H, Gall J G (March 1978).
"A tandemly repeated sequence at the termini of the extrachromosomal ribosomal
RN A genes in Tetrahymena".

Journal of Molecular Biology. 120 (1): 33-53. doi:10.1016/0022-2836(78)90294-2.
PMI D 642006. - ^ "Elizabeth H. Blackburn, Carol W. Greider, Jack W.

Szostak: The Nobel Prize in Physiology or Medicine 2009". Nobel Foundation.
2009-10-05. Retrieved 2012-06-12. - ^ Olovnikov A M (September 1973).
"A theory of marginotomy.

The incomplete copying of template margin in enzymic synthesis of
polynucleotides and biological significance of the phenomenon".
Journal of Theoretical Biology. 41 (1): 181-90. Bibcode:1973JTh Bi..41..181 O.
doi:10.1016/0022-5193(73)90198-7. PMI D 4754905.

^ Chow T T, Zhao Y, Mak S S, Shay J W, Wright W E (June 2012).

"Early and late steps in telomere overhang processing in normal human cells: the
position of the final RN A primer drives telomere shortening".
Genes & Development. 26 (11): 1167-1178. doi:10.1101/gad.187211.112.
PM C 3371406. PMI D 22661228. - ^ Nelson D L, Lehninger A L, Cox M M (2008).

Lehninger Principles of Biochemistry (5th ed.). New York: W.
ISB N 9780716771081. OCL C 191854286. - ^ Maloy S (July 12, 2002).
"Bacterial Chromosome Structure".

Retrieved 2008-06-22. - ^ Martínez P, Blasco M A (October 2010).
"Role of shelterin in cancer and aging". Aging Cell. 9 (5): 653-66.
doi:10.1111/j.1474-9726.2010.00596.x. PMI D 20569239.

^ Meyne J, Ratliff R L, Moyzis R K (September 1989).

"Conservation of the human telomere sequence (TTAGG G)n among vertebrates".
Proceedings of the National Academy of Sciences of the United States of America.
86 (18): 7049-53. Bibcode:1989PNA S...86.7049 M. doi:10.1073/pnas.86.18.7049.
PM C 297991.

PMI D 2780561. - ^ Lipps H J, Rhodes D (August 2009).
"G-quadruplex structures: in vivo evidence and function".
Trends in Cell Biology. 19 (8): 414-22. doi:10.1016/j.tcb.2009.05.002.
PMI D 19589679. - ^ Mender I, Shay J W (November 2015).

"Telomerase Repeated Amplification Protocol (TRA P)". Bio-Protocol.
5 (22): e1657. doi:10.21769/bioprotoc.1657. PM C 4863463. PMI D 27182535.

^ Lanza R P, Cibelli J B, Blackwell C, Cristofalo V J, Francis M K, Baerlocher
G M, et al.

(April 2000).
"Extension of cell life-span and telomere length in animals cloned from
senescent somatic cells".
288 (5466): 665-9. Bibcode:2000 Sci...288..665 L.
doi:10.1126/science.288.5466.665. PMI D 10784448.

S2CI D 37387314.

^ Whittemore, Kurt; Vera, Elsa; Martínez-Nevado, Eva; Sanpera, Carola; Blasco,
Maria A.
"Telomere shortening rate predicts species life span".
Proceedings of the National Academy of Sciences. 116 (30): 15122-15127.
Bibcode:2019PNA S..11615122 W. doi:10.1073/pnas.1902452116.

ISS N 0027-8424. PM C 6660761. PMI D 31285335.

^ Shay J W, Wright W E (May 2005).
"Senescence and immortalization: role of telomeres and telomerase".
Carcinogenesis.

26 (5): 867-74. doi:10.1093/carcin/bgh296. PMI D 15471900.

^ Wai L K (July 2004). "Telomeres, telomerase, and tumorigenesis--a review".
Med Gen Med. 6 (3): 19.

PM C 1435592. PMI D 15520642. - ^ Greider C W (August 1990).
"Telomeres, telomerase and senescence". Bio Essays. 12 (8): 363-9.
doi:10.1002/bies.950120803.

PMI D 2241933. S2CI D 11920124. - ^ Barnes, R. P., de Rosa, M., Thosar, S.
A., et al., Telomeric 8-oxo-guanine drives rapid premature senescence in the
absence of telomere shortening, Nature, June 30, 2022; Nat Struct Mol Biol 29,
639-652 (2022).
https://doi.org/10.1038/s41594-022-00790-y - ^ Shampay J, Szostak J W, Blackburn
E H (1984).

"DN A sequences of telomeres maintained in yeast". 310 (5973): 154-7.
Bibcode:1984 Natur.310..154 S. doi:10.1038/310154a0. PMI D 6330571.
S2CI D 4360698.

^ Williams T L, Levy D L, Maki-Yonekura S, Yonekura K, Blackburn E H (November
2010).

"Characterization of the yeast telomere nucleoprotein core: Rap1 binds
independently to each recognition site".
The Journal of Biological Chemistry. 285 (46): 35814-24. doi:10.1074/jbc.
M110.170167. PM C 2975205.

PMI D 20826803.

^ Griffith J D, Comeau L, Rosenfield S, Stansel R M, Bianchi A, Moss H, de
Lange T (May 1999).
"Mammalian telomeres end in a large duplex loop". 97 (4): 503-14.
doi:10.1016/S0092-8674(00)80760-6. PMI D 10338214. S2CI D 721901.
^ Burge S, Parkinson G N, Hazel P, Todd A K, Neidle S (2006).

"Quadruplex DN A: sequence, topology and structure". Nucleic Acids Research.
34 (19): 5402-15. doi:10.1093/nar/gkl655. PM C 1636468. PMI D 17012276.

^ Zhu, Haidong; Manson, Jo Ann E.; Cook, Nancy R.; Bekele, Bayu B.; Chen, Li;
Kane, Kevin J.; Huang, Ying; Li, Wenjun; Christen, William; Lee, I.-Min; Dong,
Yanbin (2025-05-21).

"Vitamin D3 and Marine Omega-3 Fatty Acids Supplementation and Leukocyte
Telomere Length: 4-Year Findings from the VITA L Randomized Controlled Trial".
The American Journal of Clinical Nutrition. 0 (0).
doi:10.1016/j.ajcnut.2025.05.003. ISS N 0002-9165. PMI D 40409468.

^ Chesler, Caren (2025-05-22).

"Vitamin D may slow a process related to aging, new study suggests".
The Washington Post. ISS N 0190-8286. Retrieved 2025-05-24.

^ Barnes R, Fouquerel E, Opresko P (2019).
"The impact of oxidative DN A damage and stress on telomere homeostasis".

Mechanisms of Ageing and Development. 177: 37-45. doi:10.1016/j.mad.2018.03.013.
PM C 6162185. PMI D 29604323. - ^ Reichert S, Stier A (December 2017).
"Does oxidative stress shorten telomeres in vivo?

A review". Biology Letters. 13 (12): 20170463. doi:10.1098/rsbl.2017.0463.
PM C 5746531. PMI D 29212750.

^ Shen J, Gammon M D, Terry M B, Wang Q, Bradshaw P, Teitelbaum S L, et al.

(April 2009).
"Telomere length, oxidative damage, antioxidants and breast cancer risk".
International Journal of Cancer. 124 (7): 1637-43. doi:10.1002/ijc.24105.
PM C 2727686.

PMI D 19089916.

^ a b Mathur M B, Epel E, Kind S, Desai M, Parks C G, Sandler D P, Khazeni N
(May 2016).
"Perceived stress and telomere length: A systematic review, meta-analysis, and
methodologic considerations for advancing the field".
Brain, Behavior, and Immunity.

54: 158-169. doi:10.1016/j.bbi.2016.02.002. PM C 5590630. PMI D 26853993.

^ a b c Rossiello F, Jurk D, Passos J F, di Fagagna F (2022).
"Telomere dysfunction in ageing and age-related diseases". Nature Cell Biology.

24 (2): 135-147. doi:10.1038/s41556-022-00842-x. PM C 8985209. PMI D 35165420.

^ Hoffmann J, Richardson G, Spyridopoulos I (2021).
"Telomerase as a Therapeutic Target in Cardiovascular Disease".
Arteriosclerosis, Thrombosis, and Vascular Biology.

41 (3): 1047-1061. doi:10.1161/ATVBAH A.120.315695. PMI D 33504179.

^ Aston K I, Hunt S C, Susser E, Kimura M, Factor-Litvak P, Carrell D, Aviv A
(November 2012).
"Divergence of sperm and leukocyte age-dependent telomere dynamics: implications
for male-driven evolution of telomere length in humans".

Molecular Human Reproduction. 18 (11): 517-22. doi:10.1093/molehr/gas028.
PM C 3480822. PMI D 22782639. - ^ Steenstrup T, Kark J D, Aviv A (2017).
"Telomeres and the natural lifespan limit in humans".

9 (4): 130-1142. doi:10.18632/aging.101216. PM C 5425118. PMI D 28394764.

^ Zhu, Haidong; Manson, Jo Ann E.; Cook, Nancy R.; Bekele, Bayu B.; Chen, Li;
Kane, Kevin J.; Huang, Ying; Li, Wenjun; Christen, William; Lee, I-Min; Dong,
Yanbin (2025-05-21).
"Vitamin D3 and Marine Omega-3 Fatty Acids Supplementation and Leukocyte
Telomere Length: 4-Year Findings from the VITA L Randomized Controlled Trial".

The American Journal of Clinical Nutrition. doi:10.1016/j.ajcnut.2025.05.003.
ISS N 0002-9165. - ^ Pepper G V, Bateson M, Nettle D (August 2018).
"Telomeres as integrative markers of exposure to stress and adversity: a
systematic review and meta-analysis".

Royal Society Open Science. 5 (8): 180744. Bibcode:2018RSO S....580744 P.
doi:10.1098/rsos.180744. PM C 6124068. PMI D 30225068.

^ Rentscher K E, Carroll J E, Mitchell C (April 2020).

"Psychosocial Stressors and Telomere Length: A Current Review of the Science".
Annual Review of Public Health. 41: 223-245.
doi:10.1146/annurev-publhealth-040119-094239. PMI D 31900099. S2CI D 209748557.

^ Hayflick L, Moorhead P S (December 1961).

"The serial cultivation of human diploid cell strains".
Experimental Cell Research. 25 (3): 585-621. doi:10.1016/0014-4827(61)90192-6.
PMI D 13905658. - ^ Hayflick L (March 1965).
"The limited in vitro lifetime of human diploid cell strains".

Experimental Cell Research. 37 (3): 614-36. doi:10.1016/0014-4827(65)90211-9.
PMI D 14315085.

^ Feng J, Funk W D, Wang S S, Weinrich S L, Avilion A A, Chiu C P, et al.
(September 1995). "The RN A component of human telomerase".

269 (5228): 1236-41. Bibcode:1995 Sci...269.1236 F. doi:10.1126/science.7544491.
PMI D 7544491. S2CI D 9440710.

^ Bodnar A G, Ouellette M, Frolkis M, Holt S E, Chiu C P, Morin G B, et al.
(January 1998).

"Extension of life-span by introduction of telomerase into normal human cells".
279 (5349): 349-52. Bibcode:1998 Sci...279..349 B.
doi:10.1126/science.279.5349.349. PMI D 9454332. S2CI D 35667874.

^ Nakagawa S, Gemmell N J, Burke T (September 2004).

"Measuring vertebrate telomeres: applications and limitations" (PD F).
Molecular Ecology. 13 (9): 2523-33. Bibcode:2004Mol Ec..13.2523 N.
doi:10.1111/j.1365-294 X.2004.02291.x. PMI D 15315667.

S2CI D 13841086.

^ Gomes N M, Ryder O A, Houck M L, Charter S J, Walker W, Forsyth N R, et al.
(October 2011).
"Comparative biology of mammalian telomeres: hypotheses on ancestral states and
the roles of telomeres in longevity determination".
Aging Cell.

10 (5): 761-8. doi:10.1111/j.1474-9726.2011.00718.x. PM C 3387546.
PMI D 21518243.

^ Harris S E, Martin-Ruiz C, von Zglinicki T, Starr J M, Deary I J (July
2012).
"Telomere length and aging biomarkers in 70-year-olds: the Lothian Birth Cohort
1936".
Neurobiology of Aging.

33 (7): 1486.e3-8. doi:10.1016/j.neurobiolaging.2010.11.013. PMI D 21194798.
S2CI D 10309423.

^ Lyčka, Martin; Bubeník, Michal; Závodník, Michal; Peska, Vratislav; Fajkus,
Petr; Demko, Martin; Fajkus, Jiří; Fojtová, Miloslava (2023-08-21).
"Telo Base: a community-curated database of telomere sequences across the tree
of life".

Nucleic Acids Research. 52 (D1): D311 - D321. doi:10.1093/nar/gkad672.
ISS N 0305-1048. PM C 10767889. PMI D 37602392.

^ Peška V, Fajkus P, Fojtová M, Dvořáčková M, Hapala J, Dvořáček V, et al.

(May 2015).
"Characterisation of an unusual telomere motif (TTTTTTAGG G)n in the plant
Cestrum elegans (Solanaceae), a species with a large genome".
The Plant Journal. 82 (4): 644-54. doi:10.1111/tpj.12839. PMI D 25828846.

^ Fajkus P, Peška V, Sitová Z, Fulnečková J, Dvořáčková M, Gogela R, et al.

(February 2016).
"Allium telomeres unmasked: the unusual telomeric sequence (CTCGGTTATGG G)n is
synthesized by telomerase".
The Plant Journal. 85 (3): 337-47. doi:10.1111/tpj.13115. PMI D 26716914.

S2CI D 206331112.

^ a b Fajkus, Petr; Adámik, Matej; Nelson, Andrew D L; Kilar, Agata M; Franek,
Michal; Bubeník, Michal; Frydrychová, Radmila Čapková; Votavová, Alena;
Sýkorová, Eva; Fajkus, Jiří; Peška, Vratislav (2023-01-11).
"Telomerase RN A in Hymenoptera (Insecta) switched to plant/ciliate-like
biogenesis".
Nucleic Acids Research.

51 (1): 420-433. doi:10.1093/nar/gkac1202. ISS N 0305-1048. PM C 9841428.
PMI D 36546771. - ^ Allshire R C, et al. (June 1989).

"Human telomeres contain at least three types of G-rich repeat distributed
non-randomly".
Nucleic Acids Research. 17 (12): 4611-27. doi:10.1093/nar/17.12.4611.
PM C 318019. PMI D 2664709. - ^ Rufer N, et al.

(August 1998).
"Telomere length dynamics in human lymphocyte subpopulations measured by flow
cytometry".
Nature Biotechnology. 16 (8): 743-7. doi:10.1038/nbt0898-743. PMI D 9702772.

S2CI D 23833545.

^ Lyčka, Martin; Peska, Vratislav; Demko, Martin; Spyroglou, Ioannis; Kilar,
Agata; Fajkus, Jiří; Fojtová, Miloslava (December 2021).
"WALTE R: an easy way to online evaluate telomere lengths from terminal
restriction fragment analysis".
BM C Bioinformatics.

22 (1): 145. doi:10.1186/s12859-021-04064-0. ISS N 1471-2105. PM C 7986547.
PMI D 33752601. - ^ Cawthon R M (May 2002).
"Telomere measurement by quantitative PC R".

Nucleic Acids Research. 30 (10): 47e-47. doi:10.1093/nar/30.10.e47. PM C 115301.
PMI D 12000852. - ^ Ding Z (2014).
"Estimating telomere length from whole genome sequence data".

Nucleic Acids Research. 42 (9): e75. doi:10.1093/nar/gku181. PM C 4027178.
PMI D 24609383. - ^ Farmery J (2018).
"Telomerecat: A ploidy-agnostic method for estimating telomere length from whole
genome sequencing data".

Scientific Reports. 8 (1): 1300. Bibcode:2018NatS R...8.1300 F.
doi:10.1038/s41598-017-14403-y. PM C 5778012. PMI D 29358629.

^ Feuerbach L (2019).

"Telomere Hunter-in silico estimation of telomere content and composition from
cancer genomes".
BM C Bioinformatics. 20 (1): 272. doi:10.1186/s12859-019-2851-0. PM C 6540518.
PMI D 31138115.

^ Baerlocher G M, Vulto I, de Jong G, Lansdorp P M (December 2006).

"Flow cytometry and FIS H to measure the average length of telomeres (flow FIS
H)".
Nature Protocols. 1 (5): 2365-76. doi:10.1038/nprot.2006.263. PMI D 17406480.
S2CI D 20463557. - ^ Pollack, Andrew (May 18, 2011).

"A Blood Test Offers Clues to Longevity". The New York Times.

^ von Zglinicki T (March 2012). "Will your telomeres tell your future?".
344: e1727. doi:10.1136/bmj.e1727. PMI D 22415954.

S2CI D 44594597. - ^ Marchant J (2011). "Spit test offers guide to health".
Nature. doi:10.1038/news.2011.330. - ^ Dugdale, Hannah L.; Richardson, David S.
(2018-01-15).
"Heritability of telomere variation: it is all about the environment!".

Philosophical Transactions of the Royal Society B: Biological Sciences.
373 (1741): 20160450. doi:10.1098/rstb.2016.0450. ISS N 0962-8436. PM C 5784070.
PMI D 29335377.

^ Remot, Florentin; Ronget, Victor; Froy, Hannah; Rey, Benjamin; Gaillard,
Jean-Michel; Nussey, Daniel H.; Lemaitre, Jean-François (2021-09-07).

"Decline in telomere length with increasing age across nonhuman vertebrates: A
meta-analysis".
Molecular Ecology. 31 (23): 5917-5932. doi:10.1111/mec.16145.
hdl:20.500.11820/91f3fc9e-4a69-4ac4-a8a0-45c93ccbf3b5. ISS N 0962-1083.
PMI D 34437736.

S2CI D 237328316.

^ Remot, Florentin; Ronget, Victor; Froy, Hannah; Rey, Benjamin; Gaillard,
Jean-Michel; Nussey, Daniel H.; Lemaître, Jean-François (November 2020).
"No sex differences in adult telomere length across vertebrates: a
meta-analysis".
Royal Society Open Science.

7 (11): 200548. Bibcode:2020RSO S....700548 R. doi:10.1098/rsos.200548.
ISS N 2054-5703. PM C 7735339. PMI D 33391781.

S2CI D 226291119. - ^ Pepke, Michael Le; Eisenberg, Dan T. (2021-03-16).
"On the comparative biology of mammalian telomeres: Telomere length co-evolves
with body mass, lifespan and cancer risk".
Molecular Ecology. 31 (23): 6286-6296. doi:10.1111/mec.15870.

ISS N 0962-1083. PMI D 33662151.

^ Chatelain, Marion; Drobniak, Szymon M.; Szulkin, Marta (2019-11-27).
"The association between stressors and telomeres in non-human vertebrates: a
meta-analysis".
Ecology Letters. 23 (2): 381-398. doi:10.1111/ele.13426.

ISS N 1461-023 X. PMI D 31773847. S2CI D 208319503.

^ Olsson M, Wapstra E, Friesen C (March 2018).
"Ectothermic telomeres: it's time they came in from the cold".
Philosophical Transactions of the Royal Society of London.

Series B, Biological Sciences. 373 (1741): 20160449. doi:10.1098/rstb.2016.0449.
PM C 5784069. PMI D 29335373.
External links edit- Telomeres and Telomerase: The Means to the End Nobel
Lecture by Elizabeth Blackburn, which includes a reference to the impact of
stress, and pessimism on telomere length - Telomerase and the Consequences of
Telomere Dysfunction Nobel Lecture by Carol Greider - DN A Ends: Just the
Beginning Nobel Lecture by Jack Szostak

🔗 Archive Information

Cryptographic verification ensures content authenticity and integrity

Original Source View Article
Archive Method trafilatura_extraction
Preservation Status ✅ Complete
Word Count 📝 4999 words
Topics 🏷️ #quick-read
Content Hash (SHA-256) 69ddc5e52f5ba30082aa67ae6be85d5340b4d130b8b2f7fbf5b5647034cfbcf3 Verify on Hive
Raw HTML Hash c887759183e6d9b59898df611e5c933135d6ffa4f133eb44030e6625207affd5 Verify on Hive
Integrity Hash ea0a71b81beb617bdfa69d72c47707a68df5633d77dbdc09286db3ab4985e4a5 Verify on Hive
Server Hostname en.wikipedia.org
Server Type ATS/9.2.9
SSL Certificate Hash 3d295d0ec6126c7637c590be6d9009fe2dccb5604fd5ae085bdece3052c15070
Blockchain Proof Hash 8d103c317e418149e7acc48481edd73e7807182c9c340fa07324fd924512ef27
Blockchain Ready ✅ Yes
Verification Timestamp 2025-06-03T03:27:29.164341
Authenticity Status ✅ Cryptographically Verified

This content has been archived for historical preservation and educational purposes.
🔒 Powered by ArcHive - Professional Web Content Preservation